pScalps_Puro_mCebpe
              
              
                (Plasmid
                
                #79076)
              
            
            
            
          - 
            PurposeExpression of mouse Cebpe
- 
              Depositing Lab
- 
          Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepScalps
- Backbone size w/o insert (bp) 7740
- Total vector size (bp) 8755
- 
              Vector typeLentiviral
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameCebp epsilon
- 
                  Alt nameCCAAT/Enhancer Binding Protein (C/EBP), Epsilon
- 
                  Alt nameC/EBP Epsilon
- 
                    SpeciesM. musculus (mouse)
- 
                  Insert Size (bp)1176
- 
                        Entrez GeneCebpe (a.k.a. C/EBP, C/EBPe, C/EBPepsilon, CR, CRP1, Gm294)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTTCTCGCTTCTGTTCG
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pScalps_Puro_mCebpe was a gift from Silvia Monticelli (Addgene plasmid # 79076 ; http://n2t.net/addgene:79076 ; RRID:Addgene_79076)
- 
                For your References section: TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912
Map uploaded by the depositor.
 
           
                         
            