CSII-IDR2-owlTRIMCyp-FOS
(Plasmid #79067)

• Purpose: Express owl monkey TRIMCyp in mammalan cells
• Depositing Lab: Wesley Sundquist
• Publication: Li et al Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269.

Backbone

• Vector backbone: CSII-BBN-IRES-DsRed
• Backbone manufacturer: CSII-BBN-IDR2
• Backbone size w/o insert (bp): 9866
• Total vector size (bp): 11354
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRIM5Cyp (owl monkey)-FOS
• Species: Aotus trivirgatus
• Insert Size (bp): 1422
• GenBank ID: AAT73777.1
• Promoter: CMV
• Tag / Fusion Protein:
  • OneSTrEP-FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: CAGAGCTGGTTTAGTGAACC
• 3′ sequencing primer: GCCAAAAGACGGCAATATGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CMV promoter and IRES DsRed co expression