Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-deltaR8.2(A14C,E45C,A92E)
(Plasmid #79048)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79048 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-deltaR8.2
  • Backbone size (bp) 13457
  • Modifications to backbone
    GCC->TGC (1315-1317), GAA-> TGC (1408-1410), GCA->GAA (1549-1551) A14C/E45C/A92E mutations in the CA protein
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter CMV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAAGCACAGCAAGCAGCAGC
  • 3′ sequencing primer GCTATGTGCCCTTCTTTGCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCMV-deltaR8.2 was provided by Dr. Didier Trono and A14C/E45C/A92E mutations were introduced in CA by Quikchange

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene Sanger sequencing results found C-->A missense mutation at nucleotide #25 within the pol protein; this nucleotide may differ, however, in other reference sequences for gag-pol transframe domain

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-deltaR8.2(A14C,E45C,A92E) was a gift from Wesley Sundquist (Addgene plasmid # 79048 ; http://n2t.net/addgene:79048 ; RRID:Addgene_79048)
  • For your References section:

    Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068