pCMV-deltaR8.2(A14C,E45C)
(Plasmid #79047)

• Purpose: (Empty Backbone) mammalian expression, lentiviral packaging
• Depositing Lab: Wesley Sundquist
• Publication: Li et al Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269.

Backbone

• Vector backbone: pCMV-deltaR8.2
• Backbone size (bp): 13457
• Modifications to backbone: GCC->TGC (1315-1317), GAA-> TGC (1408-1410) A14C/E45C mutations in the CA protein
• Vector type: Mammalian Expression, Lentiviral
• Promoter: CMV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AAAGCACAGCAAGCAGCAGC
• 3′ sequencing primer: GCTATGTGCCCTTCTTTGCCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pCMV-deltaR8.2 was provided by Dr. Didier Trono and A14C/E45C mutations were introduced in CA by Quikchange
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene Sanger sequencing results found C-->A missense mutation at nucleotide #25 within the pol protein; this nucleotide may differ, however, in other reference sequences for gag-pol transframe domain