Skip to main content
Addgene

pET11a-CA(A14C, E45C)
(Plasmid #79045)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79045 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET11a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5677
  • Total vector size (bp) 6340
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CA (A14C, E45C)
  • Species
    Lentivirus HIV-1
  • Insert Size (bp)
    699
  • Mutation
    A14C and E45C mutations in HIV-1 CA protein
  • GenBank ID
    AF324493.2
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TATGCTAGTTATTGCTCAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pET11a-CA(A14C, E45C) was provided by Dr. Owen Pornillos

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET11a-CA(A14C, E45C) was a gift from Wesley Sundquist (Addgene plasmid # 79045 ; http://n2t.net/addgene:79045 ; RRID:Addgene_79045)

  • For your References section:

    Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068
Related items:
Commonly requested with: