-
PurposeBacterial vector for cloning and propagation in DH5alpha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET3a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 4640
- Total vector size (bp) 5267
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOneSTrEP-FLAG- Cyclophilin A
-
Alt nameOSF-CypA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)663
-
GenBank IDNM_021130.4
-
Entrez GenePPIA (a.k.a. CYPA, CYPH, HEL-S-69p)
- Promoter T7
-
Tag
/ Fusion Protein
- OneSTrEP-FLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TATGCTAGTTATTGCTCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET3a-OSF-CypA was a gift from Wesley Sundquist (Addgene plasmid # 79039 ; http://n2t.net/addgene:79039 ; RRID:Addgene_79039) -
For your References section:
Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068