pAct:dCas9-scFv
(Plasmid
#78900)
-
PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cells
-
Depositing Lab
-
Sequence Information
-
Sequences (3) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAWG
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFV-VP64
-
Insert Size (bp)2034
- Promoter pActin (Drosophila)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTGAACGCGACTTGAGAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byscFV:VP64 cloned from Addgene 60904 into vector for Actin-driven expression in Drosophila cells
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct:dCas9-scFv was a gift from Norbert Perrimon (Addgene plasmid # 78900 ; http://n2t.net/addgene:78900 ; RRID:Addgene_78900) -
For your References section:
Comparison of Cas9 activators in multiple species. Chavez A, Tuttle M, Pruitt BW, Ewen-Campen B, Chari R, Ter-Ovanesyan D, Haque SJ, Cecchi RJ, Kowal EJ, Buchthal J, Housden BE, Perrimon N, Collins JJ, Church G. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. 10.1038/nmeth.3871 PubMed 27214048