-
PurposeExpresses 3XFLAG-dCas9-VPR (human codon) under 10XUAS control, for in vivo CRISPRa
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78897 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWalium20
-
Backbone manufacturerPerrimon Lab
- Backbone size w/o insert (bp) 9690
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5850
- Promoter 10XUAS
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAACATCCCATATTCAGCCGC
- 3′ sequencing primer TTTGTCCAATTATGTCACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9-VPR insert cloned from PMID 25730490 into pWalium20 for in vivo Drosophila expression
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWalium20-10XUAS-3XFLAG-dCas9-VPR was a gift from Norbert Perrimon (Addgene plasmid # 78897 ; http://n2t.net/addgene:78897 ; RRID:Addgene_78897) -
For your References section:
In Vivo Transcriptional Activation Using CRISPR/Cas9 in Drosophila. Lin S, Ewen-Campen B, Ni X, Housden BE, Perrimon N. Genetics. 2015 Oct;201(2):433-42. doi: 10.1534/genetics.115.181065. Epub 2015 Aug 5. 10.1534/genetics.115.181065 PubMed 26245833