acta 2
(Plasmid #78711)

• Purpose: zebrafish acta2 3-UTR–specific probe
• Depositing Lab: Sarah Childs
• Publication: Georgijevic et al Dev Dyn. 2007 Jun;236(6):1623-32.

Backbone

• Vector backbone: pBluescript
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: acta2
• Alt name: alpha-SMA
• Species: D. rerio (zebrafish)
• Insert Size (bp): 349
• Mutation: contains bp 1,243–1,591
• GenBank ID: NM_212620
• Entrez Gene: acta2 (a.k.a. wu:fb63d03)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: T7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primers used to amplify cDNA:
CCCAGCACTGTCAGGTGATT and CCCATTCCTACCATCACTCC

acta2 promoter = A 300 bp proximal promoter for acta2 and 2165 bp fragment from the acta2 intron 1. The two genomic fragments were fused in a PCR reaction to make a 2465 bp enhancer/promoter construct

Acta2 3'UTR is in reverse orientation with t1440del, t1454c and a1578g compared to reference sequence. Depositor states that these discrepancies do not affect plasmid function.