cpi-17
(Plasmid
#78708)
-
PurposeEncodes zebrafish cpi-17
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecpi-17
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)240
-
GenBank IDAY934532
-
Entrez Geneppp1r14aa (a.k.a. CPI-17, im:7147597, ppp1r14a, zgc:110700)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site EcoRV (unknown if destroyed)
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers used to amplify cDNA:
ATGGCTGAGGAGACACATAC and CTCCTCTGGCATGTCCTCA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cpi-17 was a gift from Sarah Childs (Addgene plasmid # 78708 ; http://n2t.net/addgene:78708 ; RRID:Addgene_78708) -
For your References section:
Spatiotemporal expression of smooth muscle markers in developing zebrafish gut. Georgijevic S, Subramanian Y, Rollins EL, Starovic-Subota O, Tang AC, Childs SJ. Dev Dyn. 2007 Jun;236(6):1623-32. 10.1002/dvdy.21165 PubMed 17474123