BC-A1-004
(Plasmid #78691)

• Purpose: A strong promoter drives the expression of wild type luxR, which regulates expression of GFP under the control of a weak RBS.
• Depositing Lab: Brian Chow
• Publication: Magaraci et al ACS Synth Biol. 2016 Apr 25.

Backbone

• Vector backbone: pSB1C3
• Backbone manufacturer: Registry of Standardized Biological Parts
• Backbone size w/o insert (bp): 2047
• Total vector size (bp): 4098
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Turbo
• Growth instructions: Reporter gene expression can also be assayed at room temperature (~25C).
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BBa_J23100-BBa_B0034-luxR-Terminator-pLux-BBa_B0033-GFP-Terminator
• Species: Synthetic
• Insert Size (bp): 2051

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa (VF2)
• 3′ sequencing primer: attaccgcctttgagtgagc (VR)

Resource Information

• Supplemental Documents:
  • BC-A1-004.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry