Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM1-EGFP-BarcodeV4
(Plasmid #78630)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78630 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLJM1-EGFP
  • Backbone manufacturer
    https://www.addgene.org/19319/
  • Backbone size w/o insert (bp) 8083
  • Total vector size (bp) 8365
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GESTALT lineage tracing target V4
  • Alt name
    V4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    280

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGAATTCTCGACCTCGAGACA
  • 3′ sequencing primer CGAAGCTTGAGCTCGAGATCTGAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    https://www.addgene.org/19319/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene 19319 - pLJM1-EGFP, with GESTALT V4 barcode insert at the 3' terminus of EGFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-EGFP-BarcodeV4 was a gift from Jay Shendure (Addgene plasmid # 78630 ; http://n2t.net/addgene:78630 ; RRID:Addgene_78630)
  • For your References section:

    Whole organism lineage tracing by combinatorial and cumulative genome editing. McKenna A, Findlay GM, Gagnon JA, Horwitz MS, Schier AF, Shendure J. Science. 2016 May 26. pii: aaf7907. 10.1126/science.aaf7907 PubMed 27229144