sgRNA(MS2)_Prnp_SAM2
(Plasmid
#78625)
-
PurposeEncodes sgRNA2.0 targeting 138nt upstream of TSS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonesgRNA(MS2)
- Total vector size (bp) 3010
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA(MS2)_Prnp_SAM2
-
gRNA/shRNA sequenceGGGAGTGCTGACACTGGGGG
-
SpeciesM. musculus (mouse)
-
Entrez GenePrnp (a.k.a. CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA(MS2)_Prnp_SAM2 was a gift from Walker Jackson (Addgene plasmid # 78625 ; http://n2t.net/addgene:78625 ; RRID:Addgene_78625) -
For your References section:
Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. Kaczmarczyk L, Mende Y, Zevnik B, Jackson WS. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. PONE-D-16-11813 [pii] PubMed 27128441