Skip to main content
Addgene

pX335_HR_Prnp_3
(Plasmid #78622)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78622 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX335
  • Total vector size (bp) 8437
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HR_Prnp_3
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Prnp (a.k.a. CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335_HR_Prnp_3 was a gift from Walker Jackson (Addgene plasmid # 78622 ; http://n2t.net/addgene:78622 ; RRID:Addgene_78622)
  • For your References section:

    Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. Kaczmarczyk L, Mende Y, Zevnik B, Jackson WS. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. PONE-D-16-11813 [pii] PubMed 27128441