Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRII-Topo U6-SpAi9L-U6SpDMDL
(Plasmid #78608)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78608 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR blunt II TOPO
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 4495
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    U6-SpAi9L-U6SpDMDL
  • gRNA/shRNA sequence
    AAAGAATTGATTTGATACCG; GAATAATTTCTATTATATTACA
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAA TAC GAC TCA CTA TAG GG
  • 3′ sequencing primer GAT TTA GGT GAC ACT ATA G
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo U6-SpAi9L-U6SpDMDL was a gift from Amy Wagers (Addgene plasmid # 78608 ; http://n2t.net/addgene:78608 ; RRID:Addgene_78608)
  • For your References section:

    In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686