Skip to main content
Addgene

pZac2.1 U6-SaAi9L-U6-SaAi9R
(Plasmid #78604)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78604 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pZac2.1
  • Total vector size (bp) 4214
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNAs for SaCas9 targeting Ai9 locus
  • gRNA/shRNA sequence
    CTCTAGAGTCGCAGATCCTC; ACGAAGTTATATTAAGGGTT
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SnaBI (destroyed during cloning)
  • 3′ cloning site SnaBI (destroyed during cloning)
  • 5′ sequencing primer TGTGCTGGAATTCGCCCTTA
  • 3′ sequencing primer CCTCTAGATGCATGCTCGAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 U6-SaAi9L-U6-SaAi9R was a gift from Amy Wagers (Addgene plasmid # 78604 ; http://n2t.net/addgene:78604 ; RRID:Addgene_78604)

  • For your References section:

    In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686
Related items:
Commonly requested with: