Skip to main content
Addgene

mCitrine-USP19 1-1290
(Plasmid #78595)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78595 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    mCitrine-C1
  • Backbone size w/o insert (bp) 4750
  • Total vector size (bp) 8700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    USP19 1-1290
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3954
  • GenBank ID
    NM_006677.2
  • Entrez Gene
    USP19 (a.k.a. ZMYND9)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCitrine (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCTGCAATAAACAAGTTAAC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this vector from Michael Davidson (Addgene plasmid # 54587) and inserted USP19 1-1290

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCitrine-USP19 1-1290 was a gift from Yihong Ye (Addgene plasmid # 78595 ; http://n2t.net/addgene:78595 ; RRID:Addgene_78595)

  • For your References section:

    Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555
Related items:
Commonly requested with: