mCitrine-USP19 C506S
(Plasmid
#78594)
-
PurposeExpress mCitrine-USP19 C506S in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemCitrine-C1
- Backbone size w/o insert (bp) 4750
- Total vector size (bp) 8700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP19 C506S
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3954
-
GenBank IDNM_006677.2
-
Entrez GeneUSP19 (a.k.a. ZMYND9)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCitrine (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCTGCAATAAACAAGTTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe received this vector from Michael Davidson (Addgene plasmid # 54587) and inserted USP19 C506S
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCitrine-USP19 C506S was a gift from Yihong Ye (Addgene plasmid # 78594 ; http://n2t.net/addgene:78594 ; RRID:Addgene_78594) -
For your References section:
Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555