mCherry-GFP1-10
(Plasmid #78591)

• Purpose: Express mCherry-GFP1-10 in mammalian cells
• Depositing Lab: Yihong Ye
• Publication: Lee et al Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13.

Backbone

• Vector backbone: mCherry2-C1
• Backbone size w/o insert (bp): 4750
• Total vector size (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP 1-10
• Species: Synthetic
• Insert Size (bp): 648
• GenBank ID:
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry2 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCTGCAATAAACAAGTTAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We received this vector from Michael Davidson (Addgene plasmid # 54563) and inserted GFP 1-10
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry