pRK-flag-GFP11
(Plasmid #78590)

• Purpose: Expression flag-GFP 11 in mammalian cells
• Depositing Lab: Yihong Ye
• Publication: Lee et al Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13.

Backbone

• Vector backbone: pRK
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 7100
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: flag-GFP 11
• Species: Synthetic
• Insert Size (bp): 78
• GenBank ID:
• Promoter: CMV
• Tag / Fusion Protein:
  • flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CCTACTCAGACAATGCGATGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GFP1-10 was PCR complied from a commercial vector from Sandia Biotech and cloned into Dr. Ye’s pRK vector. The tagged were added in the primers.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry