Skip to main content
Addgene

pRK-flag-USP19 1-1290
(Plasmid #78579)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRK
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 11000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    flag-USP19 1-1290
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3954
  • Mutation
    mutate 1291 residue to stop condon
  • GenBank ID
    NM_006677.2
  • Entrez Gene
    USP19 (a.k.a. ZMYND9)
  • Promoter CMV
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTACTCAGACAATGCGATGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Ye PCR amplified USP19 cDNA from a plasmid obtained from Simon Wing’s lab in Canada and then cloned them into the pRK FLAG vector we have in the lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK-flag-USP19 1-1290 was a gift from Yihong Ye (Addgene plasmid # 78579 ; http://n2t.net/addgene:78579 ; RRID:Addgene_78579)
  • For your References section:

    Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555