Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPR220.08
(Plasmid #78553)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78553 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 6544
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    uirS
  • Alt name
    ETR1
  • Alt name
    slr1212
  • Species
    Synechocystis sp. PCC 6803
  • Insert Size (bp)
    2535
  • Promoter J23108

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGCGTAGCGAGTCAGTGAG
  • 3′ sequencing primer ATCGACACGAATTATGCAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPR220.08 was a gift from Jeffrey Tabor (Addgene plasmid # 78553 ; http://n2t.net/addgene:78553 ; RRID:Addgene_78553)
  • For your References section:

    Repurposing Synechocystis PCC6803 UirS-UirR as a UV-violet/green photoreversible transcriptional regulatory tool in E. coli. Ramakrishnan P, Tabor JJ. ACS Synth Biol. 2016 Apr 27. 10.1021/acssynbio.6b00068 PubMed 27120220