pPR220.08
(Plasmid
#78553)
-
PurposePlasmid constitutively expressing phycocyanobilin (PCB) biosynthesis genes and UirS sensor kinase gene
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78553 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 6544
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameuirS
-
Alt nameETR1
-
Alt nameslr1212
-
SpeciesSynechocystis sp. PCC 6803
-
Insert Size (bp)2535
- Promoter J23108
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGCGTAGCGAGTCAGTGAG
- 3′ sequencing primer ATCGACACGAATTATGCAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPR220.08 was a gift from Jeffrey Tabor (Addgene plasmid # 78553 ; http://n2t.net/addgene:78553 ; RRID:Addgene_78553) -
For your References section:
Repurposing Synechocystis PCC6803 UirS-UirR as a UV-violet/green photoreversible transcriptional regulatory tool in E. coli. Ramakrishnan P, Tabor JJ. ACS Synth Biol. 2016 Apr 27. 10.1021/acssynbio.6b00068 PubMed 27120220