pLentiCas9-T2A-GFP
(Plasmid #78548)

• Purpose: Cas9 protein with GFP
• Depositing Labs: Roderic Guigo, Rory Johnson
• Publication: Pulido-Quetglas et al PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar.

Backbone

• Vector backbone: Lenti-Cas9-blast
• Backbone manufacturer: Addgene 52962
• Backbone size w/o insert (bp): 12859
• Total vector size (bp): 13669
• Modifications to backbone: Added T2A-GFP
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: T2A-GFP
• Insert Size (bp): 825
• Promoter: In frame with Cas9

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Gacgctgtagtcttcagagatg
• 3′ sequencing primer: CGAAGGACCGCGCACCTGGT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Compared to the provided full plasmid sequence, Addgene's quality control sequencing finds a G202S amino acid residue substitution in the EGFP fluorophore. The depositing laboratory is aware of this residue change, and it does not affect fluorophore function.

Note that, according to the depositing laboratory, this plasmid results in a weak GFP signal that may be difficult to see by microscope, but it is useful for flow cytometry.