pDECKO-mCherry MALAT1_Exon.4
(Plasmid #78543)

• Purpose: Experimental plasmid
• Depositing Labs: Roderic Guigo, Rory Johnson
• Publication: Pulido-Quetglas et al PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar.

Backbone

• Vector backbone: pDECKO_mCherry
• Total vector size (bp): 9430
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gRNA1+scaffold+H1promoter+gRNA2
• gRNA/shRNA sequence: 2 guide RNAs against MALAT1_Exon.4
• Species: H. sapiens (human)
• Promoter: U6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTACAAAATACGTGACGTAG
• 3′ sequencing primer: ATGTCTACTATTCTTTCCCC

Resource Information

• Supplemental Documents:
  • pDECKO-mCherry MALAT1_Exon.4
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Experimental plasmid.