Skip to main content
Addgene

pDECKO-mCherry MALAT1_Enhancer.2
(Plasmid #78537)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78537 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDECKO_mCherry
  • Total vector size (bp) 9430
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA1+scaffold+H1promoter+gRNA2
  • gRNA/shRNA sequence
    2 guide RNAs against MALAT1_Enhancer.2
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTACAAAATACGTGACGTAG
  • 3′ sequencing primer ATGTCTACTATTCTTTCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Experimental plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDECKO-mCherry MALAT1_Enhancer.2 was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 78537 ; http://n2t.net/addgene:78537 ; RRID:Addgene_78537)
  • For your References section:

    Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. Pulido-Quetglas C, Aparicio-Prat E, Arnan C, Polidori T, Hermoso T, Palumbo E, Ponomarenko J, Guigo R, Johnson R. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. PCOMPBIOL-D-16-01254 [pii] PubMed 28253259