Skip to main content
Addgene

pDECKO_mCherry
(Plasmid #78534)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78534 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Lentiguide-puro
  • Backbone manufacturer
    Addgene 52963
  • Backbone size (bp) 10182
  • Modifications to backbone
    Added mCherry (711 bp).
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter U6 (for expressing sgRNA)
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTACAAAATACGTGACGTAG
  • 3′ sequencing primer ATGTCTACTATTCTTTCCCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCherry was amplified from plasmid Addgene ref. 52963
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A cloning protocol can be found in the supplemental materials of the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDECKO_mCherry was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 78534 ; http://n2t.net/addgene:78534 ; RRID:Addgene_78534)
  • For your References section:

    Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. Pulido-Quetglas C, Aparicio-Prat E, Arnan C, Polidori T, Hermoso T, Palumbo E, Ponomarenko J, Guigo R, Johnson R. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. PCOMPBIOL-D-16-01254 [pii] PubMed 28253259