pFUChW nontargeting shRNA
(Plasmid #78522)

• Purpose: Lentiviral vector encoding shRNA and mCherry reporter
• Depositing Lab: David Chan
• Publication: Rojansky et al Elife. 2016 Nov 17;5. pii: e17896. doi: 10.7554/eLife.17896.

Backbone

• Vector backbone: pFUChW
• Backbone size w/o insert (bp): 10069
• Total vector size (bp): 10129
• Modifications to backbone: EGFP reporter in pFUGW replaced with mCherry
• Vector type: Lentiviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry
• gRNA/shRNA sequence: Non-targeting shRNA
• Species: M. musculus (mouse)
• Promoter: UbC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: BsrGI (unknown if destroyed)
• 5′ sequencing primer: TGTAATCATTTGGGTCAATATGTAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: modified from Addgene plasmid 25870

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry