pEx1-pEF-H2B-mCherry-T2A-rTetR-HDAC4-Zeo
(Plasmid
#78353)
-
PurposeExpresses rTetR-HDAC4 for gene silencing and the nuclear H2B-mCherry marker in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepExchange1
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 6615
- Total vector size (bp) 11655
-
Modifications to backboneoriginal CMV was replaced with pEF cut with BamHI and KpnI before Gibson inserted Zeo in the loxP site using Cre
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-mCherry-T2A-rTetR-HDAC4
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)5040
-
GenBank IDhttps://www.ncbi.nlm.nih.gov/gene/9759
-
Entrez GeneHDAC4 (a.k.a. AHO3, BDMR, HA6116, HD4, HDAC-4, HDAC-A, HDACA, NEDCHF, NEDCHID)
- Promoter pEF alpha
-
Tag
/ Fusion Protein
- rTetR (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer F1-factor: CTAAAGTGCGAAAGCGGCGG
- 3′ sequencing primer T7 primer: TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHDAC4 Flag was purchased from Addgene (https://www.addgene.org/13821/); rTetR was PCR-amplified from the rtTA3 system, Clontech
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEx1-pEF-H2B-mCherry-T2A-rTetR-HDAC4-Zeo was a gift from Michael Elowitz (Addgene plasmid # 78353 ; http://n2t.net/addgene:78353 ; RRID:Addgene_78353) -
For your References section:
Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859