pEx1-pEF-H2B-mCherry-T2A-rTetR-KRAB
(Plasmid #78348)

• Purpose: Expresses rTetR-KRAB for gene silencing and the nuclear H2B-mCherry marker in mammalian cells.
• Depositing Lab: Michael Elowitz
• Publication: Bintu et al Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956.

Backbone

• Vector backbone: pExchange1
• Backbone manufacturer: Agilent Technologies
• Backbone size w/o insert (bp): 4113
• Total vector size (bp): 6102
• Modifications to backbone: original CMV was replaced with pEF cut with BamHI and KpnI before Gibson
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H2B-mCherry-T2A-rTetR-KRAB
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1989
• GenBank ID:
• Promoter: pEF alpha
• Tag / Fusion Protein:
  • rTetR (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: F1-factor: CTAAAGTGCGAAAGCGGCGG
• 3′ sequencing primer: T7 primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pEx1-pEF-H2B-mcherry-T2A-rTetR-KRAB
• A portion of this plasmid was derived from a plasmid made by: KRAB was PCR-amplified from PSV40-E-KRAB-pA (pWW43), a plasmid gifted by Martin Fussenegger; rTetR was PCR-amplified from the rtTA3 system, Clontech

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry