hSRF-3xHA-IRES-hrGFP (#479)
(Plasmid
#78347)
-
PurposeOverexpression of human SRF ORF with a 3xHA C-terminal tag and an IRES-hrGFP reporter
-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES-2a-hrGFP
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6524
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSRF
-
Alt nameserum response factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1524
-
GenBank IDNM_003131.3
-
Entrez GeneSRF (a.k.a. MCM1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3x HA tag (C terminal on backbone)
- IRES-hrGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer AATTAACCCTCACTAAAGGG
- 3′ sequencing primer CTATTAAGCGTAGTCAGGTACATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hSRF contains G424V compared to NP_003122.1. The depositor states that this mutation should not affect plasmid function. Please contact Dr. Alexander if you have any questions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSRF-3xHA-IRES-hrGFP (#479) was a gift from Matthew Alexander & Louis Kunkel (Addgene plasmid # 78347 ; http://n2t.net/addgene:78347 ; RRID:Addgene_78347)
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/78/78347/78347-map_8LP83WRfWoA2.pdf.940x940_q85_autocrop.png)