hMYOG-3xHA-IRES-hrGFP (#324)
(Plasmid
#78341)
-
PurposeOverexpression of human MYOG ORF with a 3xHA C-terminal tag and an IRES-hrGFP reporter
-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES-2a-hrGFP
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 5750
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYOG
-
Alt namemyogenin
-
Alt namemyogenic factor 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)672
-
GenBank IDNM_002479.5
-
Entrez GeneMYOG (a.k.a. MYF4, bHLHc3, myf-4)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3x HA tag (C terminal on backbone)
- IRES-hrGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CAAGGATGACGACGATAAG
- 3′ sequencing primer CTATTAAGCGTAGTCAGGTACATC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains a 2 amino acid deletion. Does not affect function. Please contact Dr. Alexander if you have any questions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hMYOG-3xHA-IRES-hrGFP (#324) was a gift from Matthew Alexander & Louis Kunkel (Addgene plasmid # 78341 ; http://n2t.net/addgene:78341 ; RRID:Addgene_78341)
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/78/78341/78341-map_SRgT98gQ1yKh.pdf.940x940_q85_autocrop.png)