hMYOD1-3xHA-IRES-hrGFP (#343)
(Plasmid #78327)

• Purpose: Overexpression of human MYOD1 ORF with a 3xHA C-terminal tag and an IRES-hrGFP reporter
• Depositing Labs: Matthew Alexander, Louis Kunkel
• Publication: Alexander lab Muscle Factors (unpublished)

Backbone

• Vector backbone: pIRES-2a-hrGFP
• Backbone manufacturer: Agilent Technologies
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 6000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MYOD1
• Alt name: Myogenic Differentiation 1
• Species: H. sapiens (human)
• Insert Size (bp): 1000
• GenBank ID: NM_002478.4
• Entrez Gene: MYOD1 (a.k.a. CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3x HA tag (C terminal on backbone)
  • IRES-hrGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: AATTAACCCTCACTAAAGGG
• 3′ sequencing primer: CTATTAAGCGTAGTCAGGTACATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please contact Dr. Alexander if you have any questions.