pJEP206-AAV-1.3CaMKII-MCS-pA.
(Plasmid #78319)

• Purpose: (Empty Backbone) AAV vector backbone containing a 1.3CaMKIIa promoter followed by a multiple cloning site(MCS) followed by a poly-Adenylation Signal (pA)
• Depositing Lab: Jonathan Ploski
• Publication: Holehonnur et al Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone manufacturer: Agilent Technologies
• Backbone size (bp): 4331
• Modifications to backbone: Vector backbone has 75 bps 3’UTR that contains an SV40 based poly-adenylation signal.
• Vector type: AAV
• Promoter: 1.3CaMKIIa

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: ccacgcgttcgtaacattatggccttaggtcacttcatctccatggggttc

Resource Information

• Supplemental Documents:
  • pJEP206-AAV-1.3CaMKII P-MCS-pA.txt.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry