CAG-Cas9-T2A-EGFP-ires-puro
(Plasmid #78311)

• Purpose: Expresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.
• Depositing Lab: Timo Otonkoski
• Publication: Saarimaki-Vire et al Cell Rep. 2017 Apr 11;19(2):281-294. doi: 10.1016/j.celrep.2017.03.055.

Backbone

• Vector backbone: PyCAG
• Total vector size (bp): 11467
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: WT SpCas9-T2A-EGFP-ires-puromycin resistance
• Species: Streptococcus pyogenes
• Insert Size (bp): 7118
• Promoter: CAG
• Tag / Fusion Protein:
  • T2A-EGFP-ires-puro (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: NsiI (unknown if destroyed)
• 5′ sequencing primer: pCAG-F GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: M13 Reverse CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • hPSC genome editing with CAG-Cas9-T2A-GFP-IP
  • Single stem cell sorting to 96-well plates
• A portion of this plasmid was derived from a plasmid made by: PX330, Feng Zhang lab
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cas9 expressing vector for genome editing of human pluripotent stem cells. Transfectants can be selected by EGFP+ sorting or transient treatment with puromycin. Described in Saarimäki-Vire, Balboa et al- 2016.