pSpal2At
(Plasmid #78286)

• Purpose: Expresses A. thaliana PAL2 in E. coli
• Depositing Lab: David Nielsen
• Publication: McKenna et al Metab Eng. 2011 Sep;13(5):544-54. doi: 10.1016/j.ymben.2011.06.005. Epub 2011 Jun 23.

Backbone

• Vector backbone: pSTV28
• Backbone size w/o insert (bp): 2999
• Total vector size (bp): 5127
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PAL2
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2154
• Mutation: *see below
• Entrez Gene: PAL2 (a.k.a. AT3G53260, ATPAL2, phenylalanine ammonia-lyase 2)
• Promoter: lac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: ctatgaccatgattacgaattc
• 3′ sequencing primer: CCAGTGCCAAGCTTGCATGC

Resource Information

• Supplemental Documents:
  • pSpal2At Genbank file
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*Note: Addgene's quality control sequencing finds an E50A amino acid residue substitution in the A. thaliana PAL2 gene insert. The depositing laboratory does not believe this residue change will affect protein function. This plasmid accurately reflects the construct as it was used in the associated publication.