pKH-MoHyPer
(Plasmid #78267)

• Purpose: Express HyPer-AS sensor that change excitation wavelength with the presence of hydrogen peroxide.
• Depositing Labs: Jeffrey Caplan, Nicole Donofrio
• Publication: Huang et al Mol Plant Pathol. 2016 Mar 7. doi: 10.1111/mpp.12392.

Backbone

• Vector backbone: pCb1531
• Backbone size w/o insert (bp): 4339
• Total vector size (bp): 5789
• Vector type: Yeast Expression ; Express in Magnaporthe
• Selectable markers: Baialaphos

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MoHyper
• Species: S. cerevisiae (budding yeast), S. pombe (fission yeast); Magnaporthe
• Insert Size (bp): 1450
• Promoter: Rp27

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BstEII (not destroyed)
• 5′ sequencing primer: ACCATGGAAATGGCCTCTCA
• 3′ sequencing primer: TCAAACGGCCTGCTTAAGGACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry