psiCHECK2-miR-34 WT
(Plasmid #78258)

• Purpose: psiCHECK2 dual luciferase reporter harboring a fully complementary miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase gene
• Depositing Lab: Joanne Weidhaas
• Publication: Salzman et al Nat Commun. 2016 Mar 21;7:10954. doi: 10.1038/ncomms10954.

Backbone

• Vector backbone: psiCHECK-2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6273
• Total vector size (bp): 6302
• Vector type: Mammalian Expression, Luciferase ; microRNA activity

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fully complimentary miR-34 target site
• Species: Synthetic
• Insert Size (bp): 29

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGTGCTGAAGAACGAGCAGT
• 3′ sequencing primer: CAAACCCCCGCCTCCACGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note there is a single nucleotide mismatch between the published miR34 sequence and Addgene's quality control sequence. This mismatch does not affect plasmid function.