TetO-dCas9-mD3A
(Plasmid #78255)

• Purpose: Expresses dead Cas9 (dCas9) fused to inactive DNMT3A catalytic domain (CD) linked to IRES-mCherry under the control of TetOp and a minimal CMV promoter
• Depositing Lab: Grant Challen
• Publication: McDonald et al Biol Open. 2016 May 11. pii: bio.019067. doi: 10.1242/bio.019067.

Backbone

• Vector backbone: Addgene # 20321
• Total vector size (bp): 14829
• Modifications to backbone: We took out OSKM and put in new MCS site: EcoRI-XbaI-NheI-AgeI-PspXI-AscI-EcoRI
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DNMT3A CD aa 598-912
• Species: H. sapiens (human)
• Insert Size (bp): 948
• Mutation: E756A
• GenBank ID: AF480163
• Entrez Gene: DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag epitope tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: ctgcagccttcaagtacttcgacacc
• 3′ sequencing primer: ATGCTCGTCAAGAAGACAGGGCCAGGTTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry