pRSETb-pcDronpa
(Plasmid
#78183)
-
PurposeExpresses pcDronpa in E. coli strains
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSETb
- Backbone size w/o insert (bp) 2860
- Total vector size (bp) 3535
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepcDronpa
-
Insert Size (bp)675
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-tag; Xpress tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSETb-pcDronpa was a gift from Peter Dedecker (Addgene plasmid # 78183 ; http://n2t.net/addgene:78183 ; RRID:Addgene_78183) -
For your References section:
Green-to-red photoconvertible Dronpa mutant for multimodal super-resolution fluorescence microscopy. Moeyaert B, Nguyen Bich N, De Zitter E, Rocha S, Clays K, Mizuno H, van Meervelt L, Hofkens J, Dedecker P. ACS Nano. 2014 Feb 25;8(2):1664-73. doi: 10.1021/nn4060144. Epub 2014 Jan 21. 10.1021/nn4060144 PubMed 24410188