Skip to main content
Addgene

pRSETb-rsGreenF
(Plasmid #78181)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78181 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSETb
  • Backbone size w/o insert (bp) 2860
  • Total vector size (bp) 3580
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rsGreenF
  • Insert Size (bp)
    720
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-tag; Xpress tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSETb-rsGreenF was a gift from Peter Dedecker (Addgene plasmid # 78181 ; http://n2t.net/addgene:78181 ; RRID:Addgene_78181)
  • For your References section:

    Expression-Enhanced Fluorescent Proteins Based on Enhanced Green Fluorescent Protein for Super-resolution Microscopy. Duwe S, De Zitter E, Gielen V, Moeyaert B, Vandenberg W, Grotjohann T, Clays K, Jakobs S, Van Meervelt L, Dedecker P. ACS Nano. 2015 Oct 27;9(10):9528-41. doi: 10.1021/acsnano.5b04129. Epub 2015 Sep 9. 10.1021/acsnano.5b04129 PubMed 26308583
Commonly requested with: