pAAV-hSyn-FLEX-rc [Jaws-KGC-GFP-ER2]
(Plasmid
#78174)
-
PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the human synapsin promoter, in floxed/reversed (Cre-dependent) manner.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-FLEX
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 4682
- Total vector size (bp) 6332
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJaws-KGC-GFP-ER2
-
Alt nameJaws
-
SpeciesHaloarcula salinarum (stain Shark)
-
Insert Size (bp)1650
-
MutationK200R W214F
-
GenBank IDKM000926.1
- Promoter human synapsin
-
Tags
/ Fusion Proteins
- KGC (C terminal on insert)
- GFP (C terminal on insert)
- ER2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gcacgggcgcgaccatctgc
- 3′ sequencing primer gcagcgtatccacatagcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is fully sequenced in the coding sequence regions (fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro and in vivo.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene plasmid # 78174 ; http://n2t.net/addgene:78174 ; RRID:Addgene_78174) -
For your References section:
Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Chuong AS, Miri ML, Busskamp V, Matthews GA, Acker LC, Sorensen AT, Young A, Klapoetke NC, Henninger MA, Kodandaramaiah SB, Ogawa M, Ramanlal SB, Bandler RC, Allen BD, Forest CR, Chow BY, Han X, Lin Y, Tye KM, Roska B, Cardin JA, Boyden ES. Nat Neurosci. 2014 Aug;17(8):1123-9. doi: 10.1038/nn.3752. Epub 2014 Jul 6. 10.1038/nn.3752 PubMed 24997763