Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TRCN0000072225
(Plasmid #78160)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78160 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO_TRC005
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LacZ
  • gRNA/shRNA sequence
    CTCTGGCTAACGGTACGCGTA
  • Promoter hU6

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The RNAi Consortium / Broad Institute

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRCN0000072225 was a gift from William Hahn (Addgene plasmid # 78160 ; http://n2t.net/addgene:78160 ; RRID:Addgene_78160)
  • For your References section:

    Integrated genetic and pharmacologic interrogation of rare cancers. Hong AL, Tseng YY, Cowley GS, Jonas O, Cheah JH, Kynnap BD, Doshi MB, Oh C, Meyer SC, Church AJ, Gill S, Bielski CM, Keskula P, Imamovic A, Howell S, Kryukov GV, Clemons PA, Tsherniak A, Vazquez F, Crompton BD, Shamji AF, Rodriguez-Galindo C, Janeway KA, Roberts CW, Stegmaier K, van Hummelen P, Cima MJ, Langer RS, Garraway LA, Schreiber SL, Root DE, Hahn WC, Boehm JS. Nat Commun. 2016 Jun 22;7:11987. doi: 10.1038/ncomms11987. 10.1038/ncomms11987 PubMed 27329820