TRCN0000279953
(Plasmid
#78154)
-
PurposeshCDK4 targeting CDS
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78154 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO_TRC005
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCDK4
-
gRNA/shRNA sequenceACAGTTCGTGAGGTGGCTTTA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000075.3 NM_000075.3
-
Entrez GeneCDK4 (a.k.a. CMM3, PSK-J3)
- Promoter hU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hU6-F
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe RNAi Consortium / Broad Institute
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRCN0000279953 was a gift from William Hahn (Addgene plasmid # 78154 ; http://n2t.net/addgene:78154 ; RRID:Addgene_78154) -
For your References section:
Integrated genetic and pharmacologic interrogation of rare cancers. Hong AL, Tseng YY, Cowley GS, Jonas O, Cheah JH, Kynnap BD, Doshi MB, Oh C, Meyer SC, Church AJ, Gill S, Bielski CM, Keskula P, Imamovic A, Howell S, Kryukov GV, Clemons PA, Tsherniak A, Vazquez F, Crompton BD, Shamji AF, Rodriguez-Galindo C, Janeway KA, Roberts CW, Stegmaier K, van Hummelen P, Cima MJ, Langer RS, Garraway LA, Schreiber SL, Root DE, Hahn WC, Boehm JS. Nat Commun. 2016 Jun 22;7:11987. doi: 10.1038/ncomms11987. 10.1038/ncomms11987 PubMed 27329820