Skip to main content
Addgene

TRCN0000279953
(Plasmid #78154)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78154 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO_TRC005
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CDK4
  • gRNA/shRNA sequence
    ACAGTTCGTGAGGTGGCTTTA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_000075.3 NM_000075.3
  • Entrez Gene
    CDK4 (a.k.a. CMM3, PSK-J3)
  • Promoter hU6

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The RNAi Consortium / Broad Institute
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRCN0000279953 was a gift from William Hahn (Addgene plasmid # 78154 ; http://n2t.net/addgene:78154 ; RRID:Addgene_78154)
  • For your References section:

    Integrated genetic and pharmacologic interrogation of rare cancers. Hong AL, Tseng YY, Cowley GS, Jonas O, Cheah JH, Kynnap BD, Doshi MB, Oh C, Meyer SC, Church AJ, Gill S, Bielski CM, Keskula P, Imamovic A, Howell S, Kryukov GV, Clemons PA, Tsherniak A, Vazquez F, Crompton BD, Shamji AF, Rodriguez-Galindo C, Janeway KA, Roberts CW, Stegmaier K, van Hummelen P, Cima MJ, Langer RS, Garraway LA, Schreiber SL, Root DE, Hahn WC, Boehm JS. Nat Commun. 2016 Jun 22;7:11987. doi: 10.1038/ncomms11987. 10.1038/ncomms11987 PubMed 27329820