KDR gRNA (BRDN0001146819)
(Plasmid #77755)

• Purpose: 3rd generation lentiviral gRNA plasmid targeting human KDR
• Depositing Labs: John Doench, David Root
• Publication: Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437.

Backbone

• Vector backbone: lentiGuide-Puro
• Backbone manufacturer: Zhang Lab (Addgene plasmid # 52963)
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KDR
• Alt name: KDR
• Alt name: NM_002253.2
• gRNA/shRNA sequence: CAAGAACTGAACTAAATGTG
• Species: H. sapiens (human)
• Entrez Gene: KDR (a.k.a. CD309, FLK1, VEGFR, VEGFR2)
• Promoter: hU6

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: U6-F
• 3′ sequencing primer: pS2-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The gRNA was designed to target the following Genbank reference sequence(s): NM_002253.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.