pECT3
(Plasmid
#75450)
-
PurposePlasmid that serves as the PCR template to create genomic pdt3 insertions. Plasmid contains the R6K origin of replication so needs pir gene to replicate
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWM91
-
Modifications to backboneremoved sacB and lacZ genes and replaced with kan cassette from Datsenko et al. as well as the indicated pdt insertion
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepdt3
-
SpeciesE. coli
- Promoter none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AATCAGCTGTTGCCCGTCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECT3 was a gift from James Collins (Addgene plasmid # 75450 ; http://n2t.net/addgene:75450 ; RRID:Addgene_75450) -
For your References section:
Tunable protein degradation in bacteria. Cameron DE, Collins JJ. Nat Biotechnol. 2014 Dec;32(12):1276-81. doi: 10.1038/nbt.3053. Epub 2014 Nov 17. 10.1038/nbt.3053 PubMed 25402616