-
Purposecontrol shRNA vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-D(+)-U6-siRNA-CMV-GFP
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Alt namecontrol vector - shRNA does not target any rat gene
-
gRNA/shRNA sequenceAATTCTCCGAACGTGTCACGT
-
GenBank IDENSRNOG00000008656
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer none (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypAAV-D(+)-U6-siRNA-CMV-GFP was modified from pAAV-D(+)-U6-siRNA-CMV-zsGreen, which was obtained from Bing Wang, PhD, University of Pittsburgh
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-AAV-sh[control] was a gift from Edward Burton (Addgene plasmid # 75438 ; http://n2t.net/addgene:75438 ; RRID:Addgene_75438) -
For your References section:
shRNA targeting alpha-synuclein prevents neurodegeneration in a Parkinson's disease model. Zharikov AD, Cannon JR, Tapias V, Bai Q, Horowitz MP, Shah V, El Ayadi A, Hastings TG, Greenamyre JT, Burton EA. J Clin Invest. 2015 Jul 1;125(7):2721-35. doi: 10.1172/JCI64502. Epub 2015 Jun 15. 10.1172/JCI64502 PubMed 26075822