Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p-AAV-sh[control]
(Plasmid #75438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75438 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-D(+)-U6-siRNA-CMV-GFP
  • Vector type
    Mammalian Expression, AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP
  • Alt name
    control vector - shRNA does not target any rat gene
  • gRNA/shRNA sequence
    AATTCTCCGAACGTGTCACGT
  • GenBank ID
    ENSRNOG00000008656
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pAAV-D(+)-U6-siRNA-CMV-GFP was modified from pAAV-D(+)-U6-siRNA-CMV-zsGreen, which was obtained from Bing Wang, PhD, University of Pittsburgh
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-AAV-sh[control] was a gift from Edward Burton (Addgene plasmid # 75438 ; http://n2t.net/addgene:75438 ; RRID:Addgene_75438)
  • For your References section:

    shRNA targeting alpha-synuclein prevents neurodegeneration in a Parkinson's disease model. Zharikov AD, Cannon JR, Tapias V, Bai Q, Horowitz MP, Shah V, El Ayadi A, Hastings TG, Greenamyre JT, Burton EA. J Clin Invest. 2015 Jul 1;125(7):2721-35. doi: 10.1172/JCI64502. Epub 2015 Jun 15. 10.1172/JCI64502 PubMed 26075822