p-AAV-sh[control]
(Plasmid #75438)

• Purpose: control shRNA vector
• Depositing Lab: Edward Burton
• Publication: Zharikov et al J Clin Invest. 2015 Jul 1;125(7):2721-35. doi: 10.1172/JCI64502. Epub 2015 Jun 15.

Backbone

• Vector backbone: pAAV-D(+)-U6-siRNA-CMV-GFP
• Vector type: Mammalian Expression, AAV, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GFP
• Alt name: control vector - shRNA does not target any rat gene
• gRNA/shRNA sequence: AATTCTCCGAACGTGTCACGT
• GenBank ID: ENSRNOG00000008656
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (unknown if destroyed)
• 3′ cloning site: EcoR1 (unknown if destroyed)
• 5′ sequencing primer: none

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pAAV-D(+)-U6-siRNA-CMV-GFP was modified from pAAV-D(+)-U6-siRNA-CMV-zsGreen, which was obtained from Bing Wang, PhD, University of Pittsburgh
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry