pUG-amdSYM-mak10TR
(Plasmid #75433)

• Purpose: Generates truncated version of MAK10 gene, which is required for dsRNA L-A propagation in S.cerevisiae
• Depositing Lab: John McCusker
• Publication: McCusker_pUG-amdSYM-mak10TR (unpublished)

Backbone

• Vector backbone: pUG amdSYM
• Backbone manufacturer: Solis-Escalante et.al FEMS Yeast Res 13 (2013) 126–139
• Backbone size w/o insert (bp): 4807
• Total vector size (bp): 5547
• Vector type: Yeast Expression
• Selectable markers: amdS (yeast selection)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: MAK10TR
• Alt name: Truncated MAK10
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 740
• Mutation: N-terminal 740 bp of MAK10 ORF
• GenBank ID: 856657
• Promoter: Native promoter

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GGATGAGCTAATTGAAAACG

Gene/Insert 2

• Gene/Insert name: ApR
• Alt name: Ampicillin-resistance
• Species: Bacteria
• Insert Size (bp): 858

Gene/Insert 3

• Gene/Insert name: amdSYM
• Alt name: acetamidase from Aspergillus nidulans
• Alt name: Refer to Solis-Escalante et.al, FEMS Yeast Res 13 (2013) 126–139
• Promoter: PTEF

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: atgccacaatcttgggaaga

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry