Skip to main content
Addgene

pU6-1 (GB1204)
(Plasmid #75405)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75405 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUPD2
  • Backbone manufacturer
    self-made; derived from the BioBrick assembly plasmid pSB1C3
  • Backbone size w/o insert (bp) 2105
  • Total vector size (bp) 2353
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtU6-1 promoter
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    248

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gctttcgctaaggatgatttctgg
  • 3′ sequencing primer cagggtggtgacaccttgcc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-1 (GB1204) was a gift from Diego Orzaez (Addgene plasmid # 75405 ; http://n2t.net/addgene:75405 ; RRID:Addgene_75405)

  • For your References section:

    A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Vazquez-Vilar M, Bernabe-Orts JM, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. 101 [pii] PubMed 26839579
Included in kit:
Related items:
Commonly requested with: