-
PurposesgRNA1-boxB-MS2-PP7
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 8337
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA1-boxB-MS2-PP7
-
SpeciesSynthetic
-
Insert Size (bp)146
- Promoter U6
-
Tag
/ Fusion Protein
- no
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sbf I (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer cccttcaccgagggcctatttccc
- 3′ sequencing primer CTATTCTTTCCCCTGCACTGTACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Want all of the CRISPRainbow constructs? Request the set here: https://www.addgene.org/kits/pederson-crisprainbow/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLH-sgRNA1-boxB-MS2-PP7 was a gift from Thoru Pederson (Addgene plasmid # 75397 ; http://n2t.net/addgene:75397 ; RRID:Addgene_75397) -
For your References section:
Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. 10.1038/nbt.3526 PubMed 27088723