-
PurposeGATEWAY destination vector for site-specific integration into the human AAVS1/PPP1R12C locus for doxycycline-inducible gene over-expression
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneN/A
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRE-DEST
- Promoter TRE-tight
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cagctcaggttctgggagag
- 3′ sequencing primer gaaatttgtgatgctattgc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hygro-iDEST was a gift from Danwei Huangfu (Addgene plasmid # 75339 ; http://n2t.net/addgene:75339 ; RRID:Addgene_75339) -
For your References section:
Genome Editing of Lineage Determinants in Human Pluripotent Stem Cells Reveals Mechanisms of Pancreatic Development and Diabetes. Zhu Z, Li QV, Lee K, Rosen BP, Gonzalez F, Soh CL, Huangfu D. Cell Stem Cell. 2016 Apr 27. pii: S1934-5909(16)30002-9. doi: 10.1016/j.stem.2016.03.015. 10.1016/j.stem.2016.03.015 PubMed 27133796
Map uploaded by the depositor.
